hsdR

Information for hsdR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4579029-4580618 - CDS hsdM EG10458 host modification; DNA methylase M 4580819-4584385 - CDS hsdR EG10459 host restriction; endonuclease R 4584519-4585433 + CDS mrr EG10612 restriction of methylated adenine

Reported regulatory sites for hsdR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.039 4584480-4584503 R tgcag AATCAGGTAGATGTTTTTCGGCTA ctata - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back