hslJ

Information for hslJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1435284-1438808 - CDS ydbK EG13183 putative oxidoreductase; Fe-S subunit 1439345-1439767 - CDS hslJ EG13181 heat shock protein hslJ 1439878-1440867 - CDS ldhA EG13186 fermentative D-lactate dehydrogenase; NAD-dependent

Reported regulatory sites for hslJ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.771 1439850-1439869 R tgccg CTCCCCTGCATTCCAGGGGA gctga - 0 - 1.052 1439822-1439845 R agctg ATTCAGATAATCCCCAATGACCTT tcatc - 0 - 0.546 1439799-1439815 R catcc TCTATTCTTAAAATAGT cctga - 0 - -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back