hslV

Information for hslV, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4117996-4119327 - CDS hslU EG11881 heat shock protein hslVU; ATPase subunit; homologous to chaperones 4119337-4119867 - CDS hslV EG11676 heat shock protein hslVU; proteasome-related peptidase subunit 4119960-4120919 - CDS ftsN EG11529 essential cell division protein

Reported regulatory sites for hslV: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.190 4119918-4119941 R ccccc CATCTATAATTGCATTATGCCCCG tactt - 0 - 0.814 4119937-4119960 R ggttg AAACCCTCAAAATCCCCCCCATCT ataat - 0 - 0.738 4119874-4119897 R tttgt ACTCTGTATTCGTAACCAAGGGGT cagct - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back