htrA

Information for htrA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 179237-180754 + CDS dgt EG10225 deoxyguanosine triphosphate triphosphohydrolase 180884-182308 + CDS htrA EG10463 periplasmic serine protease Do; heat shock protein HtrA 182445-183620 + CDS yaeG EG12335 orf; hypothetical protein

Reported regulatory sites for htrA: Genome coordinates Source Transcription factor Transcription factor annotation 180763-180798 PMID: 9159398 cpxR transcriptional regulator in 2-component system

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.336 180770-180792 gtaaa GACGAACAATAAATTTTTACCTT ttgca cpxR 23 - 4.336 180837-180859 aatct GAAGAACACAGCAATTTTGCGTT atctg - 0 - 3.938 180863-180880 ttatc TGTTAATCGAGACTGAAA tacat - 0 - 2.479 180816-180833 ggaac TTCAGGCTATAAAACGAA tctga - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back