htrB

Information for htrB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1113487-1114713 - CDS yceE EG11343 putative transport protein 1114885-1115805 - CDS htrB EG10464 heat shock protein 1116030-1117082 + CDS yceA EG11116 orf; hypothetical protein

Reported regulatory sites for htrB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.600 1115962-1115979 R atata GCAATTATCGATAATTAA catcc - 0 - 1.600 1115937-1115954 R tccac ACATTTTACGCTACATTT gcgca - 0 - 1.566 1115895-1115911 R tattt ACAAGCGCGGCAATTTC gccca - 0 - 1.147 1115834-1115857 R gcgaa AAAATGCGACAATACATACAATTG cccga - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back