hupB

Information for hupB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 458112-460466 + CDS lon EG10542 DNA-binding; ATP-dependent protease La; heat shock K-protein 460675-460947 + CDS hupB EG10467 DNA-binding protein HU-beta; NS1 (HU-1) 461139-463010 + CDS ybaU EG13249 putative protease maturation protein

Reported regulatory sites for hupB: Genome coordinates Source Transcription factor Transcription factor annotation 460462-460482 PMID: 8913296 crp cyclic AMP receptor protein 460449-460485 PMID: 8913296 fis site-specific DNA inversion stimulation factor; DNA-binding protein; a trans activator for transcription 460398-460443 PMID: 8913296 fis site-specific DNA inversion stimulation factor; DNA-binding protein; a trans activator for transcription

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.744 460502-460525 agggc TGGCAGGCTAATTCGGGCTTGCCA gcctt - 0 - 3.744 460585-460608 ggtgt TGTAAGGGGATGGCTGGCCTGATA taact - 0 - 3.295 460489-460507 cacta ATAAAAACAGGGCTGGCAG gctaa - 0 - 3.295 460608-460626 ctgat ATAACTGCTGCGCGTTCGT acctt - 0 - 2.101 460644-460664 tcaag TGCGATATAAATTATAAAGAG gaaga - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back