hyaA

Information for hyaA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1030848-1030935 - tRNA serT EG30093 Serine tRNA1 1031362-1032480 + CDS hyaA EG10468 hydrogenase-1 small subunit 1032477-1034270 + CDS hyaB EG10469 hydrogenase-1 large subunit

Reported regulatory sites for hyaA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST SP EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.904 1031123-1031140 aaaag AAAAATAGGTCCATTTTT atcgc - 0 - 1.738 1031278-1031301 gcgat GGTTTGCCTTGCTACAGGGACGTC gcttg - 0 - 1.248 1030974-1030990 cgtgt AAACCCCTAATTTGTTT gtttg - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back