hydN

Information for hydN, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2833196-2835448 - CDS hypF EG11551 transcriptional regulatory protein 2835601-2836128 - CDS hydN EG11552 involved in electron transport from formate to hydrogen; Fe-S centers 2836277-2837290 - CDS ascG EG10087 ascBF operon repressor

Reported regulatory sites for hydN: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 8.029 2836239-2836260 R acatg TCATCGTCACTAGTGTCGATGA catcg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.292 2836186-2836204 R tttcc TTAAATAACAGTAAATTAA aaact - 0 - 1.734 2836159-2836176 R tggca TGATTTGTGAATGTATCG gcgca - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back