hyfA

Information for hyfA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2598498-2598968 + CDS bcp EG10108 bacterioferritin comigratory protein 2599182-2599838 + CDS hyfA EG11150 hydrogenase 4 Fe-S subunit 2599838-2601856 + CDS hyfB EG11282 hydrogenase 4 membrane subunit

Reported regulatory sites for hyfA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.381 2599053-2599070 tcccc TGCGACACGGGTGTCGAA tccat - 0 - - 0.027 2598968-2598987 gcctg ATTACTTTGCTCCATTCCGT gctgg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back