hypA

Information for hypA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2847997-2848458 - CDS hycA EG10474 transcriptional repression of hyc and hyp operons 2848670-2849020 + CDS hypA EG10483 pleiotrophic effects on 3 hydrogenase isozymes 2849024-2849896 + CDS hypB EG10484 guanine-nucleotide binding protein; functions as nickel donor for large subunit of hydrogenase 3

Reported regulatory sites for hypA: Genome coordinates Source Transcription factor Transcription factor annotation 2848563-2848602 PMID: 8034727 & DPInteract fhlA formate hydrogen-lyase transcriptional activator for fdhF hyc and hyp operons 2848663-2848689 PMID: 10206709 modE molybdate uptake regulatory protein

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.780 2848568-2848588 cgccg TGTCGACGTGTCATTTCGACA tcatc fhlA 21 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.853 2848467-2848483 caggt TACCCGTTTAACAGAGA tgcca - 0 - 3.536 2848507-2848530 tttgt GCCAACTTTTAATTTATTGTTATT aaaga - 0 - 3.536 2848616-2848639 ggata ATCAACACTGGCACAATTATTGCT tgtag - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back