ibpA

Information for ibpA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3864096-3864530 - CDS ibpB EG11535 heat shock protein 3864636-3865049 - CDS ibpA EG11534 heat shock protein 3865280-3865687 + CDS yidQ EG11712 orf; hypothetical protein

Reported regulatory sites for ibpA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.724 3865085-3865101 R ctgac CTGTCCATTGTGGAAGG tctta - 0 - 2.996 3865212-3865228 R ccctc AGTCTATGCAATAGACC ataaa - 0 - 2.438 3865113-3865135 R cgatg AGGACGCGCCTGATGGGTGTTCT ggcta - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back