ibpB

Information for ibpB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3862239-3863924 - CDS yidE EG11536 putative transport protein 3864096-3864530 - CDS ibpB EG11535 heat shock protein 3864636-3865049 - CDS ibpA EG11534 heat shock protein

Reported regulatory sites for ibpB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 8.551 3864580-3864600 R tctcc ATGCTCGCCGTCAGGGAGCAT atgcg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.845 3864533-3864549 R cttac TCGCTTCTTAGAAGGAG aaatg - 0 - 4.463 3864611-3864627 R cctaa GGCCGCCTGGCGCGGCC tgaca - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back