idnT

Information for idnT, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4487709-4488707 - CDS idnR EG12538 L-idonate transcriptional regulator 4488774-4490093 - CDS idnT EG12539 L-idonate transporter 4490155-4490919 - CDS idnO EG12540 5-keto-D-gluconate 5-reductase

Reported regulatory sites for idnT: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.962 4490123-4490140 R tacgt GCAGCGCGAAAGCGCTGC ttttc - 0 - 0.740 4490103-4490126 R aagcg CTGCTTTTCTGGCACTAATAAGAG ataaa - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back