ilvB

Information for ilvB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3848429-3848719 - CDS ilvN EG10502 acetolactate synthase I; valine sensitive; small subunit 3848723-3850411 - CDS ilvB EG10494 acetolactate synthase I;valine-sensitive; large subunit 3850517-3850615 - CDS ivbL EG11275 ilvB operon leader peptide

Reported regulatory sites for ilvB: Genome coordinates Source Transcription factor Transcription factor annotation 3850703-3850724 DPInteract crp cyclic AMP receptor protein 3850716-3850763 DPInteract ihf integration host factor (IHF) 3850536-3850609 PMID: 2578464 stem-loop attenuator 3850462-3850492 PMID: 2578464 stem-loop attenuator

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.274 3850464-3850487 R aaacc CCGCCGGCGCAAACCGGGCGGGGT ttttc stem-loop 24 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.866 3850749-3850768 R gacga AACCTCGCTCCGGCGGGGTT ttttg ihf 15 - 2.727 3850685-3850706 R ccctc AATTTTCCCTTGCTGAAAAATT ttcca crp 4 - 2.727 3850660-3850681 R ttttc CATTGTCTCCCCTGTAAAGCTG tgctt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back