ilvG_1

Information for ilvG_1, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3947945-3948043 + CDS ilvL EG11270 ilvGEDA operon leader peptide 3948183-3949166 + CDS ilvG_1 EG10498 acetolactate synthase II; large subunit; cryptic; interrupted 3949824-3950087 + CDS ilvM EG10501 acetolactate synthase II; valine insensitive; small subunit

Reported regulatory sites for ilvG_1: Genome coordinates Source Transcription factor Transcription factor annotation 3947796-3947843 DPInteract ihf integration host factor (IHF) 3948023-3948070 DPInteract ihf integration host factor (IHF) 3947949-3948092 Neidhardt (2nd edition) E.coli and Salmonella stem-loop attenuator

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.999 3948068-3948090 taaga CCCCCGCACCGAAAGGTCCGGGG gtttt stem-loop ihf 23 3 - 5.047 3948006-3948027 tatcc CACCGTGCGGGGCTGCACTTGG acgag stem-loop ihf 22 5 - 4.686 3948035-3948055 gagga AAGGCTTAGAGATCAAGCCTT aacga stem-loop ihf 21 21 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back