ilvI

ilvI

Information for ilvI, and also upstream and downstream flanking genes:

Genome coordinates	Orientation	Gene type	Name	EcoGene	Annotation
84191-85312	+	CDS	leuO	EG10531	probable transcriptional activator for leuABCD operon
85540-87354	+	CDS	ilvI	EG10500	acetolactate synthase III; valine sensitive; large subunit
87357-87848	+	CDS	ilvH	EG10499	acetolactate synthase III; valine sensitive; small subunit

Reported regulatory sites for ilvI:

Genome coordinates	Source	Transcription factor	Transcription factor annotation
85337-85361	DPInteract	lrp	regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system
85368-85392	DPInteract	lrp	regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system
85453-85477	DPInteract	lrp	regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system
85484-85508	DPInteract	lrp	regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system
85519-85543	DPInteract	lrp	regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system
85533-85557	DPInteract	lrp	regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system

Species with an ortholog: SP EC

Predictions with an average map value >= the critical MAP value (p=0.05):

Avg. MAP

Genome coordinates

Sequence

Site type

Overlap (bp)

Repeat

Model logo

Prediction logo

Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05):

Avg. MAP	Genome coordinates	Sequence	Site type	Overlap (bp)	Repeat	Model logo	Prediction logo	Prediction alignment
1.163	85406-85425	ctatt TTAGGATTAATTAAAAAAAT agaga	-	0	-
0.507	85329-85346	atagg TCAGACATGAATGTCTGG tttat	lrp	10	-		-
0.276	85357-85379	tctgc ATTTTTTATTGAATGTAGAATTT tattc	lrp	17	-
0.276	85473-85495	caatt TAATCCTCTGTAATGGAGGATTT tatcg	lrp	17	-

Critical MAP values: