ilvY

Information for ilvY, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3952952-3954496 + CDS ilvA EG10493 threonine deaminase (dehydratase) 3954548-3955441 - CDS ilvY EG10503 positive regulator for ilvC 3955591-3957066 + CDS ilvC EG10495 ketol-acid reductoisomerase

Reported regulatory sites for ilvY: Genome coordinates Source Transcription factor Transcription factor annotation 3955461-3955487 DPInteract ilvY positive regulator for ilvC 3955492-3955518 DPInteract ilvY positive regulator for ilvC

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.142 3955493-3955513 R gaaat TTATTGCGGAAATTGATATAT tcaca ilvY 21 - 5.142 3955462-3955482 R acgtc ACATTGCAATTTTTGCAACGT caaca ilvY 21 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.541 3955514-3955534 R attga ATTCACTATATGACAGGAAAT ttatt ilvY 5 - 0.042 3955552-3955570 R tgttg TGCTTCTTATTGTTCGGTT cgcgt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back