imp

Information for imp, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 53416-54702 - CDS surA EG10985 survival protein 54755-57109 - CDS imp EG11569 organic solvent tolerance 57364-58179 + CDS yabH EG11570 putative DNA binding protein

Reported regulatory sites for imp: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.658 57240-57262 R ctata ATTTGCATTATCATACCTGTCAT tcaat - 0 - 3.390 57320-57337 R ggata TCAGGGCTATCTCCCACA atata - 0 - 3.390 57263-57280 R tcaat TGTGGGACATCGCCTATA atttg - 0 - 1.862 57179-57202 R cggac AGGATTAACACTAGCGTAGAGATG acgag - 0 - 1.862 57126-57149 R ttgtc ACGCGCAACGTTACCGATGATGGA acaat - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back