inaA

Information for inaA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2346534-2346788 + CDS yfaE EG12360 orf; hypothetical protein 2346842-2347492 - CDS inaA EG11422 pH-inducible protein involved in stress response 2347707-2347913 + CDS yfaH EG12881 orf; hypothetical protein

Reported regulatory sites for inaA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.000 2347505-2347528 R ctata GTCATTGTCGTTAATAAAAATGAC aggcg - 0 - -

Critical MAP values: p=0.01 3.34 p=0.05 2.41 p=0.1 2.01 p=0.2 1.55

Click here to go back