katE

Information for katE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1811445-1811708 - CDS b1731 EG13992 orf; hypothetical protein 1811891-1814152 + CDS katE EG10509 catalase; hydroperoxidase HPII(III) 1814410-1815159 - CDS ydjC EG12198 orf; hypothetical protein

Reported regulatory sites for katE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.622 1811717-1811740 aaaaa TCAGAAAAACTGTAGTTTAGCCGA tttag - 0 - 1.007 1811822-1811837 tggtg GTCTATAGTTAGAGAG ttttt - 0 - 0.784 1811861-1811882 ggccc TTTCAGTAATAAATTAAGGAGA cgagt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back