katG

Information for katG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4130196-4131086 + CDS metF EG10585 5;10-methylenetetrahydrofolate reductase 4131415-4133595 + CDS katG EG10511 catalase; hydroperoxidase HPI(I) 4133655-4134593 + CDS yijE EG11902 orf; hypothetical protein

Reported regulatory sites for katG: Genome coordinates Source Transcription factor Transcription factor annotation 4131318-4131356 DPInteract oxyR activator hydrogen peroxide-inducible genes

Species with an ortholog: SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.698 4131337-4131358 atcgc ATCCGTGGATTAATTCAATTAT aactt oxyR 20 - 2.479 4131377-4131399 cgctg TGTATCGTAACGGTAACACTGTA gaggg - 0 - 1.501 4131245-4131260 gcatt TGTCCGAATTCGGACA taatc - 0 - -

Critical MAP values: p=0.01 6.09 p=0.05 4.94 p=0.1 4.37 p=0.2 3.74

Click here to go back