kbl

Information for kbl, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3787947-3788972 - CDS tdh EG10993 threonine dehydrogenase 3788982-3790178 - CDS kbl EG10512 2-amino-3-ketobutyrate CoA ligase (glycine acetyltransferase) 3790453-3791325 - CDS htrL EG11188 involved in lipopolysaccharide biosynthesis

Reported regulatory sites for kbl: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.927 3790258-3790280 R tacac GTTATTTATCCTGAATTTTGCAG aagtg - 0 - 2.927 3790195-3790217 R tttgg GTAATATGTGCTGGAATTTGCCC tgtct - 0 - 2.600 3790383-3790404 R aggaa AAATGATGCTTTGGCATCATTT tttct - 0 - 2.600 3790236-3790257 R tgcag AAGTGTTAACGCGTTATCTCGT cgcga - 0 - 1.370 3790344-3790364 R caatg CAGTAAAATCAATCATCATTA tgccc - 0 - 1.370 3790274-3790294 R gagag ACATCAAGTTACACGTTATTT atcct - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back