kdpA

Information for kdpA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 724211-726259 - CDS kdpB EG10514 ATPase of high-affinity potassium transport system; B chain 726282-727955 - CDS kdpA EG10513 ATPase of high-affinity potassium transport system; A chain 728357-728563 + CDS ybfA EG11521 orf; hypothetical protein

Reported regulatory sites for kdpA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.336 728156-728171 R ctaaa CATTAGTTAAATCATG gcttt - 0 - 2.792 727965-727984 R tggtt TATGCCCTGATCAATGCGGA ggcgt - 0 - 2.630 728093-728111 R agatt TTTGCGAAATCTTTGCAGC cagaa - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back