kduI
 
Information for kduI, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
2980519-2981280
-
CDS
2-deoxy-D-gluconate 3-dehydrogenase
2981310-2982146
-
CDS
kduI
homolog of pectin degrading enzyme 5-keto 4-deoxyuronate isomerase
2982433-2983617
-
CDS
putative acyltransferase
 
Reported regulatory sites for kduI:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
7.835
2982255-2982277 R
actta AAAATGAAACATTGTTTTATTTT taatt
-
0
-
7.835
2982188-2982210 R
tagag AAAACGAAACAGTGTTTCACTAT cgttt
-
0
-
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
0.222
2982378-2982395 R
ccgtc ATTAATCTGTTGAATAAT gatgg
-
0
-
0.032
2982347-2982363 R
caagt CGACATACATTTTCTGG gctcc
-
0
-
 
Critical MAP values:
p=0.01
7.30
p=0.05
6.05
p=0.1
5.26
p=0.2
4.60

Click here to go back