kduI

Information for kduI, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2980519-2981280 - CDS kduD EG12361 2-deoxy-D-gluconate 3-dehydrogenase 2981310-2982146 - CDS kduI EG13096 homolog of pectin degrading enzyme 5-keto 4-deoxyuronate isomerase 2982433-2983617 - CDS yqeF EG13097 putative acyltransferase

Reported regulatory sites for kduI: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.835 2982255-2982277 R actta AAAATGAAACATTGTTTTATTTT taatt - 0 - 7.835 2982188-2982210 R tagag AAAACGAAACAGTGTTTCACTAT cgttt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.222 2982378-2982395 R ccgtc ATTAATCTGTTGAATAAT gatgg - 0 - 0.032 2982347-2982363 R caagt CGACATACATTTTCTGG gctcc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back