kgtP

Information for kgtP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2722199-2722471 + CDS yfiM EG12857 orf; hypothetical protein 2722468-2723766 - CDS kgtP EG10522 alpha-ketoglutarate permease 2724089-2724208 - rRNA rrfG EG30075 5S rRNA of rrnG operon

Reported regulatory sites for kgtP: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST PA EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.194 2723849-2723868 R ttaag GTTGCATAATGATATGCAAC aaatg - 0 - - 2.300 2724054-2724075 R gcgaa AGGCCATCCTGACGGATGGCCT ttttg - 0 - 0.365 2723870-2723889 R tcctg CTAACTAAATTCATGGTTAA ggttg - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back