kup

Information for kup, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3927224-3928744 - CDS yieN EG11731 putative 2-component regulator 3928943-3930502 + CDS kup EG11541 low affinity potassium transport system 3930941-3931396 + CDS rbsD EG10817 D-ribose high-affinity transport system; membrane-associated protein

Reported regulatory sites for kup: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.166 3928867-3928889 ccgtt AATCGTGCATACTGTGCGCTTTT ttgtg - 0 - 3.766 3928892-3928914 ttttt GTGGGCCAAGGGACTAAGCACAC atttc - 0 - 1.094 3928773-3928792 tagac GTTTCTTGCTGGTGGCTAAA atagt - 0 - 1.094 3928814-3928833 ggtat TTTTCTTTGAGCCAGGTTAA tgtgg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back