lacI

Information for lacI, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 362455-365529 - CDS lacZ EG10527 beta-D-galactosidase 365652-366734 - CDS lacI EG10525 transcriptional repressor of the lac operon 366811-367758 - CDS mhpR EG20276 transcriptional regulator for mhp operon

Reported regulatory sites for lacI: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.963 366775-366796 R atggc GCAAAACCTTTCGCGGTATGGC atgat - 0 -

Critical MAP values: p=0.01 4.11 p=0.05 2.92 p=0.1 2.48 p=0.2 2.01

Click here to go back