lacZ

Information for lacZ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 361150-362403 - CDS lacY EG10526 galactoside permease (M protein) 362455-365529 - CDS lacZ EG10527 beta-D-galactosidase 365652-366734 - CDS lacI EG10525 transcriptional repressor of the lac operon

Reported regulatory sites for lacZ: Genome coordinates Source Transcription factor Transcription factor annotation 365618-365639 DPInteract crp cyclic AMP receptor protein 365547-365567 DPInteract lacI transcriptional repressor of the lac operon 365639-365659 DPInteract lacI transcriptional repressor of the lac operon 365146-365166 DPInteract lacI transcriptional repressor of the lac operon

Species with an ortholog: EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.229 365617-365638 R caatt AATGTGAGTTAGCTCACTCATT aggca crp 21 - 0.669 365547-365567 R tgtgg AATTGTGAGCGGATAACAATT tcaca lacI 21 - -

Critical MAP values: p=0.01 4.78 p=0.05 3.24 p=0.1 2.72 p=0.2 2.16

Click here to go back