lasT

Information for lasT, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4637971-4638111 + CDS yjjY EG12601 orf; hypothetical protein 4638511-4639197 + CDS lasT EG12309 orf; hypothetical protein 190-255 + CDS thrL EG11277 thr operon leader peptide

Reported regulatory sites for lasT: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.030 4638231-4638247 tcaca TTATTTTAATAATCCAA ctagt - 0 - 3.030 4638298-4638314 agatt TATTTTTTATAAAATTA tccta - 0 - 2.419 4638086-4638105 tgtca TCCTAACCATTTTAACAGCA acata - 0 - 2.383 4638427-4638442 cttac GTTAAGAATTTGTAAA ttcgc - 0 -

Critical MAP values: p=0.01 6.09 p=0.05 4.94 p=0.1 4.37 p=0.2 3.74

Click here to go back