ldcC

Information for ldcC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 208621-209580 + CDS accA EG11647 acetylCoA carboxylase; carboxytransferase component; alpha subunit 209679-211820 + CDS ldcC EG13219 lysine decarboxylase 2; constitutive 211850-212266 + CDS yaeR EG13224 orf; hypothetical protein

Reported regulatory sites for ldcC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.465 209660-209676 ggaag GATTTTCCAGGAGGAAC acatg - 0 - 1.029 209598-209621 ctgaa AAAGGGTCACTTCGGTGGCCCTTT tttat - 0 - - 0.244 209581-209597 cgtaa TTCGCAAAAGTTCTGAA aaagg - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back