lepA

Information for lepA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2702355-2703329 - CDS lepB EG10530 leader peptidase (signal peptidase I) 2703345-2705144 - CDS lepA EG10529 GTP-binding elongation factor; may be inner membrane protein 2705342-2705821 - CDS rseC EG13178 sigma-E factor; negative regulatory protein

Reported regulatory sites for lepA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.082 2705169-2705184 R taaaa GCCTGGTTAACCGGGC attaa - 0 - 1.927 2705146-2705168 R cgggc ATTAAGGCACAATAATCATACTT tatga - 0 - 1.485 2705306-2705325 R ttgtt GCATTTTGCATAACAAATGC gagga - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back