leuA

Information for leuA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 80867-81961 - CDS leuB EG11577 3-isopropylmalate dehydrogenase 81958-83529 - CDS leuA EG11226 2-isopropylmalate synthase 83622-83708 - CDS leuL EG11280 leu operon leader peptide

Reported regulatory sites for leuA: Genome coordinates Source Transcription factor Transcription factor annotation 83632-83699 Neidhardt (2nd edition) E.coli and Salmonella stem-loop attenuator

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.438 83577-83600 R acaaa AAACCCGCGCCATTGCGCGGGTTT tttta - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.943 83704-83719 R atctg GAGCTGATTTAATGAC tcaca - 0 - 1.464 83915-83938 R ccctt TTTCCTCGTTGATTAGATGCAAAA attta - 0 - 1.464 83739-83762 R catcc GTTTTTGTATCCAGTAACTCTAAA agcat - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back