leuO
 
Information for leuO, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
83622-83708
-
CDS
leu operon leader peptide
84191-85312
+
CDS
leuO
probable transcriptional activator for leuABCD operon
85540-87354
+
CDS
acetolactate synthase III; valine sensitive; large subunit
 
Reported regulatory sites for leuO:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
3.554
84035-84057
atatt ATTGATCAATTAATGTTAAGAAT taatg
-
0
-
3.554
84064-84086
aatgc ATTAAATATATAAATTAATTATT aaata
-
0
-
1.819
83818-83833
tccgt AAAATTAGCTAATTGT gctgc
-
0
-
1.729
84146-84168
attag ATTGTTTTCGCAACAAAAACATT atgga
-
0
-
 
Critical MAP values:
p=0.01
7.59
p=0.05
6.45
p=0.1
5.76
p=0.2
5.04

Click here to go back