leuO

Information for leuO, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 83622-83708 - CDS leuL EG11280 leu operon leader peptide 84191-85312 + CDS leuO EG10531 probable transcriptional activator for leuABCD operon 85540-87354 + CDS ilvI EG10500 acetolactate synthase III; valine sensitive; large subunit

Reported regulatory sites for leuO: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.554 84035-84057 atatt ATTGATCAATTAATGTTAAGAAT taatg - 0 - 3.554 84064-84086 aatgc ATTAAATATATAAATTAATTATT aaata - 0 - 1.819 83818-83833 tccgt AAAATTAGCTAATTGT gctgc - 0 - 1.729 84146-84168 attag ATTGTTTTCGCAACAAAAACATT atgga - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back