leuS

Information for leuS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 670828-671409 - CDS rlpB EG10855 a minor lipoprotein 671424-674006 - CDS leuS EG10532 leucine tRNA synthetase 674241-674723 + CDS ybeL EG12851 putative alpha helical protein

Reported regulatory sites for leuS: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.265 674063-674085 R acgtt TGGGCTATGCTATGCGGATCTGA aaaac - 0 - 3.043 674032-674051 R acctc AACGCTACATTTGTAGCCGT attga - 0 - 0.742 674010-674026 R attga AAACAGGACCACTGGCT gccat - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back