lgt

Information for lgt, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2962383-2963177 - CDS thyA EG11002 thymidylate synthetase 2963184-2964059 - CDS lgt EG12128 phosphatidylglycerol-prolipoprotein diacylglyceryl transferase; a major membrane phospholipid 2964210-2966456 - CDS ptsP EG12188 PTS system; enzyme I; transcriptional regulator (with NPR and NTR proteins)

Reported regulatory sites for lgt: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.866 2964140-2964155 R ccctt GTGCTATTATTCGCAC ctttg - 0 - 1.794 2964183-2964202 R cggat CATATACATATCTTTTAACG gtatc - 0 - 1.535 2964076-2964093 R gttct CTTTCAGCGAAATAACAA gaact - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back