lhr

Information for lhr, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1726371-1727018 + CDS rnt EG11547 RNase T; degrades tRNA 1727111-1731727 + CDS lhr EG11548 member of ATP-dependent helicase superfamily II 1731778-1732125 - CDS ydhD EG12181 orf; hypothetical protein

Reported regulatory sites for lhr: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.493 1727016-1727037 aggtg TAATCGAGTCGATGCCTGATGA catgc - 0 - 0.464 1727089-1727105 gcatg ATATTCACGGGGAATAG cgtta - 0 - -

Critical MAP values: p=0.01 3.34 p=0.05 2.41 p=0.1 2.01 p=0.2 1.55

Click here to go back