lipA

Information for lipA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 658170-658373 + CDS ybeC EG11305 orf; hypothetical protein 658474-659439 - CDS lipA EG11306 lipoate synthesis; sulfur insertion? 659648-660448 - CDS ybeF EG11594 putative transcriptional regulator LYSR-type

Reported regulatory sites for lipA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.483 659500-659520 R cgtta ATTCAAAAATAGTTGATAATT acaac - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.005 659556-659576 R cattt TCGCGACCGCTTTGGCTGCTT tcagg - 0 - 1.697 659448-659471 R gcttt CCTTCGTAATTCGCAACTGGAACA cgcac - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back