lipB

Information for lipB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 659648-660448 - CDS ybeF EG11594 putative transcriptional regulator LYSR-type 660860-661435 - CDS lipB EG11591 protein of lipoate biosynthesis 661602-661865 - CDS ybeD EG11592 orf; hypothetical protein

Reported regulatory sites for lipB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.057 661486-661501 R ccgtt TTGTATCAGGATAAAA ttctt - 0 - 1.332 661451-661474 R tccgc CAGCTCGGTCTTCAGCCTTACGAG ccaat - 0 - 1.263 661437-661459 R ttcag CCTTACGAGCCAATCTCCCAGGC tatgc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back