lipB
 
Information for lipB, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
659648-660448
-
CDS
putative transcriptional regulator LYSR-type
660860-661435
-
CDS
lipB
protein of lipoate biosynthesis
661602-661865
-
CDS
orf; hypothetical protein
 
Reported regulatory sites for lipB:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: HI PA SP ST EC VC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
3.057
661486-661501 R
ccgtt TTGTATCAGGATAAAA ttctt
-
0
-
1.332
661451-661474 R
tccgc CAGCTCGGTCTTCAGCCTTACGAG ccaat
-
0
-
1.263
661437-661459 R
ttcag CCTTACGAGCCAATCTCCCAGGC tatgc
-
0
-
 
Critical MAP values:
p=0.01
4.80
p=0.05
3.45
p=0.1
2.95
p=0.2
2.42

Click here to go back