livH

Information for livH, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3591834-3593111 - CDS livM EG10541 high-affinity branched-chain amino acid transport 3593108-3594034 - CDS livH EG10538 high-affinity branched-chain amino acid transport system; membrane component 3594082-3595191 - CDS livK EG10540 high-affinity leucine-specific transport system; periplasmic binding protein

Reported regulatory sites for livH: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.046 3594052-3594073 R tccca CCGCCCGTAAAATGCGGGCGGG tttag - 0 - 1.196 3594036-3594051 R gcggg TTTAGAAAGGTTACCT tatgt - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back