livJ

Information for livJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3595615-3595998 + CDS yhhK EG12211 orf; hypothetical protein 3596186-3597346 - CDS livJ EG10539 high-affinity amino acid transport system; periplasmic binding protein 3597560-3598414 - CDS rpoH EG10897 RNA polymerase; sigma(32) factor; regulation of proteins induced at high temperatures

Reported regulatory sites for livJ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 9.880 3597378-3597399 R tatgt TTTAGCAGAGTATGCTGCTAAA gcacg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.121 3597517-3597540 R cagag AACCCTGGATGAGAGTCCGGGGTT tttgt - 0 - 2.466 3597407-3597429 R aatag CTATTCCAATATCATAAAAATCG ggtat - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back