livK

Information for livK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3593108-3594034 - CDS livH EG10538 high-affinity branched-chain amino acid transport system; membrane component 3594082-3595191 - CDS livK EG10540 high-affinity leucine-specific transport system; periplasmic binding protein 3595615-3595998 + CDS yhhK EG12211 orf; hypothetical protein

Reported regulatory sites for livK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.452 3595512-3595528 R ggcag GTGATTAATTTTTTAAC agcaa - 0 - 3.376 3595374-3595395 R acttt TTTCTGTTTATCTATCAATAAA ttcag - 0 - 3.376 3595225-3595246 R tctga TTTGTTAACACATAAAAACAAA gcaac - 0 - 3.313 3595440-3595462 R agcat AATCCCCTGAATGATAGTGAATT attcc - 0 - 3.313 3595330-3595352 R ttctt AATCGACTGAAAAATAGGGATTT taatc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back