lldP

Information for lldP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3774292-3774654 + CDS yibL EG11964 orf; hypothetical protein 3775026-3776681 + CDS lldP EG11961 L-lactate permease 3776681-3777457 + CDS lldR EG11962 transcriptional regulator

Reported regulatory sites for lldP: Genome coordinates Source Transcription factor Transcription factor annotation 3774893-3774907 DPInteract arcA negative response regulator of genes in aerobic pathways (sensors ArcB and CpxA)

Species with an ortholog: PA SP ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.810 3774811-3774827 acaag AATTGGCCCTACCAATT cttcg - 0 - 6.810 3774937-3774953 aacac AATTGGCAGTGCCACTT ttaca - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.307 3774888-3774910 tgcca ATACATAACATTTAGTTAACCAT tcatt arcA 15 - 1.998 3774914-3774933 attca TTGTCATTATCCCTACACAA cacaa - 0 -

Critical MAP values: p=0.01 6.09 p=0.05 4.94 p=0.1 4.37 p=0.2 3.74

Click here to go back