lpdA

Information for lpdA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 125695-127587 + CDS aceF EG10025 pyruvate dehydrogenase (dihydrolipoyltransacetylase component) 127912-129336 + CDS lpdA EG10543 lipoamide dehydrogenase (NADH); component of 2-oxodehydrogenase and pyruvate complexes; L-protein of glycine cleavage complex 129407-131260 - CDS yacH EG12315 putative membrane protein

Reported regulatory sites for lpdA: Genome coordinates Source Transcription factor Transcription factor annotation 127680-127712 PMID: 9868788 & DPInteract arcA negative response regulator of genes in aerobic pathways (sensors ArcB and CpxA)

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.177 127690-127711 aaaaa TTGTTAACAATTTTGTAAAATA ccgac arcA 22 - 3.078 127593-127616 gtaaa AGAGCCGGCCCAACGGCCGGCTTT tttct - 0 - 2.900 127721-127739 cggat AGAACGACCCGGTGGTGGT taggg - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back