lpp

Information for lpp, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1753722-1755134 + CDS pykF EG10804 pyruvate kinase I (formerly F); fructose stimulated 1755445-1755681 + CDS lpp EG10544 murein lipoprotein 1755745-1756749 - CDS ynhG EG14015 orf; hypothetical protein

Reported regulatory sites for lpp: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 8.325 1755409-1755431 aacgc TACATGGAGATTAACTCAATCTA gaggg - 0 - 6.309 1755383-1755403 cataa AAAACTTTGTGTAATACTTGT aacgc - 0 - 6.210 1755216-1755238 aataa AAAATCAAATCGGATTTCACTAT ataat - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back