lpxC

Information for lpxC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 105305-106456 + CDS ftsZ EG10347 cell division; forms circumferential ring; tubulin-like GTP-binding protein and GTPase 106557-107474 + CDS lpxC EG10265 UDP-3-O-acyl N-acetylglucosamine deacetylase; lipid A biosynthesis 107630-108217 + CDS yacA EG11087 orf; hypothetical protein

Reported regulatory sites for lpxC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.064 106482-106503 ttcga GGCTCTTTGTGCTAAACTGGCC cgccg - 0 - 3.983 106506-106526 gcccg CCGAATGTATAGTACACTTCG gttgg - 0 - 3.685 106533-106556 ttgga TAGGTAATTTGGCGAGATAATACG atgat - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back