lrp

Information for lrp, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 930308-931273 - CDS trxB EG11032 thioredoxin reductase 931818-932312 + CDS lrp EG10547 regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system 932447-936436 + CDS ftsK EG13226 cell division protein

Reported regulatory sites for lrp: Genome coordinates Source Transcription factor Transcription factor annotation 931468-931492 DPInteract lrp regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system 931501-931525 DPInteract lrp regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.989 931347-931364 atgac GATTTTGTTAACAATTTG tgcaa - 0 - 2.989 931487-931504 tctgg CATGTTGTACTAAAAATC gatgt lrp 10 - 2.609 931505-931523 aaatc GATGTTTTGCTTTGACAAT cccct lrp 19 - 2.609 931529-931547 cccct GGTGTTTTGCGAAAACATT cgagg - 0 - 1.739 931645-931668 acaga CGCCATTCGTGATGTCGATAGCTG ccaca - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back