lysC

Information for lysC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4228938-4229210 - CDS yjbD EG11922 orf; hypothetical protein 4229463-4230812 - CDS lysC EG10550 aspartokinase III; lysine sensitive 4231337-4232986 + CDS pgi EG10702 glucosephosphate isomerase

Reported regulatory sites for lysC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.824 4230953-4230976 R agggg CTGAATCCCCTGGGTTGTCACCAG aagcg - 0 - 1.864 4231264-4231285 R agcgc CAGTCACAGAAAAATGTGATGG tttta - 0 - 1.163 4231118-4231133 R ctcac CCTTTATTTATAAATG tacta - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back