lysR

Information for lysR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2975659-2976921 - CDS lysA EG10549 diaminopimelate decarboxylase 2977043-2977978 + CDS lysR EG10551 positive regulator for lys 2977965-2978657 - CDS ygeA EG11157 putative resistance proteins

Reported regulatory sites for lysR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.355 2976972-2976993 aaaag AATAAAAAATATCGATTTATGT cgagt - 0 - 3.355 2977004-2977025 ctatg CAAAAATGATATGGATTACCGG attgc - 0 - 2.635 2976939-2976958 ataag TGCTTTTTTATGATTACGCC acatc - 0 - 1.330 2976923-2976945 gcata ACAAACTCCAGATAAGTGCTTTT ttatg - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back