malF

Information for malF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4240205-4241095 - CDS malG EG10556 part of maltose permease; inner membrane 4241110-4242654 - CDS malF EG10555 part of maltose permease; periplasmic 4242808-4243998 - CDS malE EG10554 periplasmic maltose-binding protein; substrate recognition for transport and chemotaxis

Reported regulatory sites for malF: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.105 4242770-4242793 R atgcc GGATGCGGCGTGAACGCCTTGTCC ggcct - 0 REP315c (24) 6.105 4242678-4242701 R ttgtc GGATAAGGCGTGAAAGCCTTATCC gtcct - 0 REP315a (24)

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.160 4242709-4242728 R acgcg TCAGCGTCGCATCAGGCAGT tgttg - 0 REP315b (17)

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back