malP

Information for malP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3545619-3547703 - CDS malQ EG10561 4-alpha-glucanotransferase (amylomaltase) 3547713-3550106 - CDS malP EG10560 maltodextrin phosphorylase 3550718-3553423 + CDS malT EG10562 positive regulator of mal regulon

Reported regulatory sites for malP: Genome coordinates Source Transcription factor Transcription factor annotation 3550212-3550221 DPInteract malT positive regulator of mal regulon 3550199-3550208 DPInteract malT positive regulator of mal regulon 3550176-3550185 DPInteract malT positive regulator of mal regulon

Species with an ortholog: HI ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.908 3550148-3550164 R aacat CGAGCCTGGCAAACTAG cgata - 0 - 3.837 3550572-3550594 R ctgaa TTTGCACTGTGTCACAATTCCAA atctt crp 19 - 3.171 3550165-3550181 R gcagg ATGAGGAAGGTCAACAT cgagc malT 6 -

Critical MAP values: p=0.01 6.09 p=0.05 4.94 p=0.1 4.37 p=0.2 3.74

Click here to go back